Ben Bova SETI Article

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to write on 21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines that are
| intelligent, and can reproduce themselves endlessly. Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can make a living at it
| :-)

At this stage of development the nanobots will be able to analyse/re-program
themselves.

| Are the computers going to dig up their own silicon, etc etc ?
| Will the oil last long enough to inherit the universe?

Sand. Also if they are in space... lots of raw material.

| IMHO we have reached peak world oil production, and from here on the price
| of fuel can only increase rapidly (like it did in USSR before the collapse),
| making international trade and our whole 'intelligent' way of life
| impossible, including our intelligent machines.

Whereas if you create true *Minds* as in Ian 'M' Banks novels they will be able
to solve all our problems.

Richard
- --
================================================== ======================
~ My Reply-To address will blacklist you. Use the one below.
================================================== ======================
CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGATCTGCCACATCG
CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATCCTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.2.3-nr1 (Windows XP)
Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org

iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ CeJRkf
n1Obxgg8s2qty/HEhf2Kj30=
=to/o
-----END PGP SIGNATURE-----

(Jason H.) wrote in sci.astro.seti:

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...71,NPDN_14960_
2501214,00.html


Observation: we are intelligent, short lived and self-destructive. We are
carbon based.
Conclusion = because we are, all carbon based intelligence is short lived
and self-destructive.


pessimistic view = we are carbon based, intelligent, violent, short lived.
Maybe every intelligent life is that way.
Because we think that might be so, it is so. Because it is so, not only we
are intelligent, short lived, but every carbon based intelligence is.
Conclusion: no contact possible.

optimistic view = Our carbon based intelligence can develop machines,
which will outlive us. Because all carbon based intelligences are like us,
they will develop machines as well. Because all carbon based intelligence
are like us, they are short lived. Because our machines might oulive us,
theirs will also.
Conclusion: we'll only contact their machines.

Maybe the article would be more valuable if he got out of that mental
"simon says" straightjacket.
Ben Bova is a name in SF, but certainly not one in proper reasoning.

--
CeeBee


"I am not a crook"

(Jason H.) wrote in sci.astro.seti:

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...71,NPDN_14960_
2501214,00.html


Observation: we are intelligent, short lived and self-destructive. We are
carbon based.
Conclusion = because we are, all carbon based intelligence is short lived
and self-destructive.


pessimistic view = we are carbon based, intelligent, violent, short lived.
Maybe every intelligent life is that way.
Because we think that might be so, it is so. Because it is so, not only we
are intelligent, short lived, but every carbon based intelligence is.
Conclusion: no contact possible.

optimistic view = Our carbon based intelligence can develop machines,
which will outlive us. Because all carbon based intelligences are like us,
they will develop machines as well. Because all carbon based intelligence
are like us, they are short lived. Because our machines might oulive us,
theirs will also.
Conclusion: we'll only contact their machines.

Maybe the article would be more valuable if he got out of that mental
"simon says" straightjacket.
Ben Bova is a name in SF, but certainly not one in proper reasoning.

--
CeeBee


"I am not a crook"

Are you saying that humans are going to invent nanobots that think for
themselves?
- when we don't even know ourselves how we think,
or how to write programs without bugs in,
let alone how to write programs that re-program themselves?
Who is going to test that the nanobots' programs don't have bugs in?

Even if all this was possible before the oil runs out,
will the thinking nanobots think it is a good idea to (boldly) go and
inherit the universe?
If they meet other nanobots along the way, will they both decide to join
forces or try to exterminate each other?
If they have any vestige of US culture left in them at that stage, I know
what I would put my money on.
----------------------------------------------------------------------------
-----------------

"Richard Harrison" wrote in message
...
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to write on
21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines that are
| intelligent, and can reproduce themselves endlessly. Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can make a living at
it
| :-)

At this stage of development the nanobots will be able to
analyse/re-program
themselves.

Are you saying that humans are going to invent nanobots that think for
themselves?
- when we don't even know ourselves how we think,
or how to write programs without bugs in,
let alone how to write programs that re-program themselves?
Who is going to test that the nanobots' programs don't have bugs in?

Even if all this was possible before the oil runs out,
will the thinking nanobots think it is a good idea to (boldly) go and
inherit the universe?
If they meet other nanobots along the way, will they both decide to join
forces or try to exterminate each other?
If they have any vestige of US culture left in them at that stage, I know
what I would put my money on.
----------------------------------------------------------------------------
-----------------

"Richard Harrison" wrote in message
...
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to write on
21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines that are
| intelligent, and can reproduce themselves endlessly. Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can make a living at
it
| :-)

At this stage of development the nanobots will be able to
analyse/re-program
themselves.

"Richard Harrison" wrote in message
...
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to
write on 21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines
that are
| intelligent, and can reproduce themselves endlessly.
Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can
make a living at it
| :-)

At this stage of development the nanobots will be able to
analyse/re-program
themselves.

Yup. Or, rebuild themselves and/or replicate
themselves--babybots? Nanunanabots?

| Are the computers going to dig up their own silicon, etc
etc ?
| Will the oil last long enough to inherit the universe?

Sand. Also if they are in space... lots of raw material.

Sure--comets have plenty raw materials and the Oort cloud
enough for millions of years at least. And solar energy is
out there galore--besides, why does ComputerDoctor assume
oil is the only source of energy even on Earth; besides
solar, wind, water wave, and geothermal, just 2 words,
nuclear energy (fission and fusion!)

| IMHO we have reached peak world oil production, and from
here on the price
| of fuel can only increase rapidly (like it did in USSR
before the collapse),
| making international trade and our whole 'intelligent'
way of life
| impossible, including our intelligent machines.

Whereas if you create true *Minds* as in Ian 'M' Banks
novels they will be able
to solve all our problems.

Sure, and long before even the oil gives out. Bank's
advanced "minds" allow for a commodity-free Culture, i.e.,
completely cost-free goods makes the concept of possessions
unnecessary. I'd settle for a culture with only 1% of
today's cost. Feasible in maybe a few centuries on Earth?
...tonyC

Richard
- --

================================================== ==========
============
~ My Reply-To address will blacklist you. Use the
one below.

================================================== ==========
============

CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGA
TCTGCCACATCG

CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATC
CTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613 (tm) rich at
mibnet.plus.com
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.2.3-nr1 (Windows XP)
Comment: Using GnuPG with Thunderbird -
http://enigmail.mozdev.org


iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ Ce
JRkf
n1Obxgg8s2qty/HEhf2Kj30=
=to/o
-----END PGP SIGNATURE-----

"Richard Harrison" wrote in message
...
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to
write on 21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines
that are
| intelligent, and can reproduce themselves endlessly.
Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can
make a living at it
| :-)

At this stage of development the nanobots will be able to
analyse/re-program
themselves.

Yup. Or, rebuild themselves and/or replicate
themselves--babybots? Nanunanabots?

| Are the computers going to dig up their own silicon, etc
etc ?
| Will the oil last long enough to inherit the universe?

Sand. Also if they are in space... lots of raw material.

Sure--comets have plenty raw materials and the Oort cloud
enough for millions of years at least. And solar energy is
out there galore--besides, why does ComputerDoctor assume
oil is the only source of energy even on Earth; besides
solar, wind, water wave, and geothermal, just 2 words,
nuclear energy (fission and fusion!)

| IMHO we have reached peak world oil production, and from
here on the price
| of fuel can only increase rapidly (like it did in USSR
before the collapse),
| making international trade and our whole 'intelligent'
way of life
| impossible, including our intelligent machines.

Whereas if you create true *Minds* as in Ian 'M' Banks
novels they will be able
to solve all our problems.

Sure, and long before even the oil gives out. Bank's
advanced "minds" allow for a commodity-free Culture, i.e.,
completely cost-free goods makes the concept of possessions
unnecessary. I'd settle for a culture with only 1% of
today's cost. Feasible in maybe a few centuries on Earth?
...tonyC

Richard
- --

================================================== ==========
============
~ My Reply-To address will blacklist you. Use the
one below.

================================================== ==========
============

CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGA
TCTGCCACATCG

CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATC
CTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613 (tm) rich at
mibnet.plus.com
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.2.3-nr1 (Windows XP)
Comment: Using GnuPG with Thunderbird -
http://enigmail.mozdev.org


iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ Ce
JRkf
n1Obxgg8s2qty/HEhf2Kj30=
=to/o
-----END PGP SIGNATURE-----

"ComputerDoctor" wrote in message ...
Are you saying that humans are going to invent nanobots that think for
themselves?

Probably.

- when we don't even know ourselves how we think,

We do not need to know how we think, and more importantly, machines
programs do not need to function like a biological computer in order
to act in apparently intelligent ways. The Turing test only requires
the machine to execute logical functions and communicate them in a way
that is indistinguishable from a human.

or how to write programs without bugs in,

Not every program has 'fatal-error' bugs, and many can recover
themselves to prior 'safe' states once bugs are detected.

let alone how to write programs that re-program themselves?

Actually, the program and the hardware to do that are already in the
Smithsonian Museum. Deep Blue, the famous IBM machine that beat the
then (1997)world chess champion Gary Kasparov possessed the ability to
self-write code and the original programmers didn't know precisely HOW
it beat Kasparov.

Consider visiting the following link

http://researchweb.watson.ibm.com/re...deepblue.shtml

"...Since the match five years ago, IBM has proposed a grand challenge
and is currently working with academia, governments and other
corporations to address this looming problem posed by the complexity
of IT infrastructure. Called 'autonomic computing,' this called for
computers to manage themselves with greater than human-like abilities
for use across a wide range of business and commercial applications,
from e-sourcing to data-mining to resource allocation."

Basically they were saying that IT's incredible growth is out-pacing
the ability of human IT managers to control it, so it is necessary for
the machines to take over the job. They are using the 'deep blue'
approach to solving this problem. It is already under-way.

Who is going to test that the nanobots' programs don't have bugs in?


The machines will.

Jason H.

"ComputerDoctor" wrote in message ...
Are you saying that humans are going to invent nanobots that think for
themselves?

Probably.

- when we don't even know ourselves how we think,

We do not need to know how we think, and more importantly, machines
programs do not need to function like a biological computer in order
to act in apparently intelligent ways. The Turing test only requires
the machine to execute logical functions and communicate them in a way
that is indistinguishable from a human.

or how to write programs without bugs in,

Not every program has 'fatal-error' bugs, and many can recover
themselves to prior 'safe' states once bugs are detected.

let alone how to write programs that re-program themselves?

Actually, the program and the hardware to do that are already in the
Smithsonian Museum. Deep Blue, the famous IBM machine that beat the
then (1997)world chess champion Gary Kasparov possessed the ability to
self-write code and the original programmers didn't know precisely HOW
it beat Kasparov.

Consider visiting the following link

http://researchweb.watson.ibm.com/re...deepblue.shtml

"...Since the match five years ago, IBM has proposed a grand challenge
and is currently working with academia, governments and other
corporations to address this looming problem posed by the complexity
of IT infrastructure. Called 'autonomic computing,' this called for
computers to manage themselves with greater than human-like abilities
for use across a wide range of business and commercial applications,
from e-sourcing to data-mining to resource allocation."

Basically they were saying that IT's incredible growth is out-pacing
the ability of human IT managers to control it, so it is necessary for
the machines to take over the job. They are using the 'deep blue'
approach to solving this problem. It is already under-way.

Who is going to test that the nanobots' programs don't have bugs in?


The machines will.

Jason H.

On Tue, 23 Dec 2003, ComputerDoctor wrote:

Are you saying that humans are going to invent nanobots that think for
themselves?

As soon a brain cells can think for themselves.

- when we don't even know ourselves how we think,

of if

or how to write programs without bugs in,

A feature is a bug which has become accepted.

let alone how to write programs that re-program themselves?

That has been considered bad form for so long most people have
forgotten it was an early programming trick to deal with only 1k of program
space in a big machine.

Who is going to test that the nanobots' programs don't have bugs in?

Prison inmates?

Even if all this was possible before the oil runs out,
will the thinking nanobots think it is a good idea to (boldly) go and
inherit the universe?

Not knowing how they will function, it may be their prime directive.
If they have some weird objective like eliminating cancer and organic life
on earth goes away they may choose to look for cancers to eliminate.

If they meet other nanobots along the way, will they both decide to join
forces or try to exterminate each other?

Automata wars have been around for some time but not very popular
these days.

If they have any vestige of US culture left in them at that stage, I know
what I would put my money on.

How could they possibly have any human culture?

--
2003 11 16: The Pope condemns Israel's apartheid wall.
2003 12 16: The Pope praises Mel Gibson's The Passion.
2003 12 18: Israel's Mossad warns of an Arab attack on the Vatican.
No one ever said Israel was subtle.
-- The Iron Webmaster, 2980