A Space & astronomy forum. SpaceBanter.com

Go Back   Home » SpaceBanter.com forum » Astronomy and Astrophysics » SETI
Site Map Home Authors List Search Today's Posts Mark Forums Read Web Partners

Ben Bova SETI Article



 
 
Thread Tools Display Modes
  #1  
Old December 21st 03, 06:32 AM
Jason H.
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.
  #2  
Old December 21st 03, 02:43 PM
Rich
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article



Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

Rich

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.


  #3  
Old December 21st 03, 02:43 PM
Rich
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article



Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

Rich

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.


  #4  
Old December 21st 03, 09:03 PM
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

Rich :
Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}


I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).
See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201
  #5  
Old December 21st 03, 09:03 PM
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

Rich :
Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}


I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).
See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201
  #8  
Old December 21st 03, 11:46 PM
ComputerDoctor
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

Ben Bova wrote:
" We are nearing the point where we can produce machines that are
intelligent, and can reproduce themselves endlessly. Perhaps it is
intelligent machines who will inherit the universe. "


Does anyone have any idea what he is talking about here?
I presume the intelligent machines are our computers.
The MTBF of these machines is pathetically short,
and the software needs such careful tending that I can make a living at it
:-)
Are the computers going to dig up their own silicon, etc etc ?
Will the oil last long enough to inherit the universe?

IMHO we have reached peak world oil production, and from here on the price
of fuel can only increase rapidly (like it did in USSR before the collapse),
making international trade and our whole 'intelligent' way of life
impossible, including our intelligent machines.


  #9  
Old December 21st 03, 11:46 PM
ComputerDoctor
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

Ben Bova wrote:
" We are nearing the point where we can produce machines that are
intelligent, and can reproduce themselves endlessly. Perhaps it is
intelligent machines who will inherit the universe. "


Does anyone have any idea what he is talking about here?
I presume the intelligent machines are our computers.
The MTBF of these machines is pathetically short,
and the software needs such careful tending that I can make a living at it
:-)
Are the computers going to dig up their own silicon, etc etc ?
Will the oil last long enough to inherit the universe?

IMHO we have reached peak world oil production, and from here on the price
of fuel can only increase rapidly (like it did in USSR before the collapse),
making international trade and our whole 'intelligent' way of life
impossible, including our intelligent machines.


  #10  
Old December 22nd 03, 11:06 PM
Richard Harrison
external usenet poster
 
Posts: n/a
Default Ben Bova SETI Article

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to write on 21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines that are
| intelligent, and can reproduce themselves endlessly. Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can make a living at it
| :-)

At this stage of development the nanobots will be able to analyse/re-program
themselves.

| Are the computers going to dig up their own silicon, etc etc ?
| Will the oil last long enough to inherit the universe?

Sand. Also if they are in space... lots of raw material.

| IMHO we have reached peak world oil production, and from here on the price
| of fuel can only increase rapidly (like it did in USSR before the collapse),
| making international trade and our whole 'intelligent' way of life
| impossible, including our intelligent machines.

Whereas if you create true *Minds* as in Ian 'M' Banks novels they will be able
to solve all our problems.

Richard
- --
================================================== ======================
~ My Reply-To address will blacklist you. Use the one below.
================================================== ======================
CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGATCTGCCACATCG
CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATCCTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.2.3-nr1 (Windows XP)
Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org

iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ CeJRkf
n1Obxgg8s2qty/HEhf2Kj30=
=to/o
-----END PGP SIGNATURE-----
 




Thread Tools
Display Modes

Posting Rules
You may not post new threads
You may not post replies
You may not post attachments
You may not edit your posts

vB code is On
Smilies are On
[IMG] code is On
HTML code is Off
Forum Jump

Similar Threads
Thread Thread Starter Forum Replies Last Post
A brief list of things that show pseudoscience Vierlingj Astronomy Misc 1 May 14th 04 08:38 PM
Wanted: S&T article from 1958 Russ Amateur Astronomy 1 October 22nd 03 03:28 PM
Shuttle Program is NASA's Vietnam; Unworkable (Homer Hickam article) ElleninLosAngeles Space Shuttle 15 September 13th 03 12:09 AM
Challenger/Columbia, here is your chance to gain a new convert! John Maxson Space Shuttle 38 September 5th 03 07:48 PM


All times are GMT +1. The time now is 09:40 AM.


Powered by vBulletin® Version 3.6.4
Copyright ©2000 - 2025, Jelsoft Enterprises Ltd.
Copyright ©2004-2025 SpaceBanter.com.
The comments are property of their posters.