![]() |
|
|
Thread Tools | Display Modes |
#6
|
|||
|
|||
![]()
-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1 ComputerDoctor randomly hit the keyboard and managed to write on 21/12/2003 23:46: | Ben Bova wrote: | " We are nearing the point where we can produce machines that are | intelligent, and can reproduce themselves endlessly. Perhaps it is | intelligent machines who will inherit the universe. " | | Does anyone have any idea what he is talking about here? | I presume the intelligent machines are our computers. Nanobots. | The MTBF of these machines is pathetically short, | and the software needs such careful tending that I can make a living at it | :-) At this stage of development the nanobots will be able to analyse/re-program themselves. | Are the computers going to dig up their own silicon, etc etc ? | Will the oil last long enough to inherit the universe? Sand. Also if they are in space... lots of raw material. | IMHO we have reached peak world oil production, and from here on the price | of fuel can only increase rapidly (like it did in USSR before the collapse), | making international trade and our whole 'intelligent' way of life | impossible, including our intelligent machines. Whereas if you create true *Minds* as in Ian 'M' Banks novels they will be able to solve all our problems. ![]() Richard - -- ================================================== ====================== ~ My Reply-To address will blacklist you. Use the one below. ================================================== ====================== CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.2.3-nr1 (Windows XP) Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ CeJRkf n1Obxgg8s2qty/HEhf2Kj30= =to/o -----END PGP SIGNATURE----- |
Thread Tools | |
Display Modes | |
|
|
![]() |
||||
Thread | Thread Starter | Forum | Replies | Last Post |
A brief list of things that show pseudoscience | Vierlingj | Astronomy Misc | 1 | May 14th 04 08:38 PM |
Wanted: S&T article from 1958 | Russ | Amateur Astronomy | 1 | October 22nd 03 03:28 PM |
Shuttle Program is NASA's Vietnam; Unworkable (Homer Hickam article) | ElleninLosAngeles | Space Shuttle | 15 | September 13th 03 12:09 AM |
Challenger/Columbia, here is your chance to gain a new convert! | John Maxson | Space Shuttle | 38 | September 5th 03 07:48 PM |