Ben Bova SETI Article

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.

Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html

BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

Rich

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.

Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

http://www.naplesnews.com/npdn/pe_co...501214,00.html

BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

Rich

(if you like or want to know more about Mr. Bova's science fiction
writing, you might consider visiting the link I saw there to
http://www.benbova.net)

Regards, Jason H.

Rich :
Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).
See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201

Rich :
Jason H. replied:
Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)

BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}

I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).
See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201

replied:
Rich :

Jason H. replied:

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}


I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).

WRT finding radio emissions from distant intelligences, that's a long shot
that may well not pay off even under the best circumstances.

But I think for this I'd invoke Fermi's paradox, as this scenario removes
(pretty much) the constraints of biological life WRT interstellar travel.

Rich

See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201

replied:
Rich :

Jason H. replied:

Article - Ben Bova: Is the search for intelligent extraterrestrial
life fruitless? - By Ben Bova (14 Dec. 2003)


BB Very likely, when SETI finally succeeds, we will meet intelligent machines.

Well, he is a SF writer. :^}


I believe the same view has been expressed by several SETI scientists
such as Steven Dick and Seth Shostak. (And also seems not unreasonable
to me too).

WRT finding radio emissions from distant intelligences, that's a long shot
that may well not pay off even under the best circumstances.

But I think for this I'd invoke Fermi's paradox, as this scenario removes
(pretty much) the constraints of biological life WRT interstellar travel.

Rich

See e.g.
http://www.astrobiology.com/asc2002/...html?ascid=201

Ben Bova wrote:
" We are nearing the point where we can produce machines that are
intelligent, and can reproduce themselves endlessly. Perhaps it is
intelligent machines who will inherit the universe. "


Does anyone have any idea what he is talking about here?
I presume the intelligent machines are our computers.
The MTBF of these machines is pathetically short,
and the software needs such careful tending that I can make a living at it
:-)
Are the computers going to dig up their own silicon, etc etc ?
Will the oil last long enough to inherit the universe?

IMHO we have reached peak world oil production, and from here on the price
of fuel can only increase rapidly (like it did in USSR before the collapse),
making international trade and our whole 'intelligent' way of life
impossible, including our intelligent machines.

Ben Bova wrote:
" We are nearing the point where we can produce machines that are
intelligent, and can reproduce themselves endlessly. Perhaps it is
intelligent machines who will inherit the universe. "


Does anyone have any idea what he is talking about here?
I presume the intelligent machines are our computers.
The MTBF of these machines is pathetically short,
and the software needs such careful tending that I can make a living at it
:-)
Are the computers going to dig up their own silicon, etc etc ?
Will the oil last long enough to inherit the universe?

IMHO we have reached peak world oil production, and from here on the price
of fuel can only increase rapidly (like it did in USSR before the collapse),
making international trade and our whole 'intelligent' way of life
impossible, including our intelligent machines.

-----BEGIN PGP SIGNED MESSAGE-----
Hash: SHA1

ComputerDoctor randomly hit the keyboard and managed to write on 21/12/2003 23:46:

| Ben Bova wrote:
| " We are nearing the point where we can produce machines that are
| intelligent, and can reproduce themselves endlessly. Perhaps it is
| intelligent machines who will inherit the universe. "
|
| Does anyone have any idea what he is talking about here?
| I presume the intelligent machines are our computers.

Nanobots.

| The MTBF of these machines is pathetically short,
| and the software needs such careful tending that I can make a living at it
| :-)

At this stage of development the nanobots will be able to analyse/re-program
themselves.

| Are the computers going to dig up their own silicon, etc etc ?
| Will the oil last long enough to inherit the universe?

Sand. Also if they are in space... lots of raw material.

| IMHO we have reached peak world oil production, and from here on the price
| of fuel can only increase rapidly (like it did in USSR before the collapse),
| making international trade and our whole 'intelligent' way of life
| impossible, including our intelligent machines.

Whereas if you create true *Minds* as in Ian 'M' Banks novels they will be able
to solve all our problems.

Richard
- --
================================================== ======================
~ My Reply-To address will blacklist you. Use the one below.
================================================== ======================
CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATG CCTCAATAGATCTGCCACATCG
CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAA GTGTGGCATCCTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613 (tm) rich at mibnet.plus.com
-----BEGIN PGP SIGNATURE-----
Version: GnuPG v1.2.3-nr1 (Windows XP)
Comment: Using GnuPG with Thunderbird - http://enigmail.mozdev.org

iD8DBQE/53jqDehCPPrjI9gRAsWgAKCNNvEUzjoTU2POuoyXXwPgB1CGbQ CeJRkf
n1Obxgg8s2qty/HEhf2Kj30=
=to/o
-----END PGP SIGNATURE-----